Gènes et cancers: que faut-il savoir sur le sujet?

Dernière mise à jour 05/12/13 | Article
Gènes et cancers: que faut-il savoir sur le sujet?
Les recherches fondamentales en génomique du cancer ne cessent de progresser. Mais elles se traduisent encore rarement en progrès médicaux concrets. Tout va peut-être changer. La question est de savoir quand.

Est-il véritablement utile de savoir que la mutation du gène dénommé KRAS est impliquée dans nombreux cas de cancers colorectaux? De savoir que la protéine p53 est mutée dans plusieurs types de cancers? Ou encore de connaître les centaines de mutations génétiques apparaissant dans les cellules tumorales aux quatre coins du pays? Ces questions n'ont rien d'ironique. Si vous ne travaillez pas pour un laboratoire de recherche –public ou privé– à quoi bon connaître la liste des mutations génétiques cancérigènes? La plupart d'entre elles ne débouchent pas sur des traitements adaptés.

Voilà plusieurs dizaines d'années déjà que nous savons que les mutations génétiques peuvent être liées aux cancers: les premiers oncogènes humains (gènes qui provoquent le cancer) ont été découverts au début des années 1980. La croissance exponentielle de la génomique du cancer est le fruit du Projet génome humain  et de projets secondaires comme l'Atlas du génome du cancer (un projet collaboratif financé par l'Etat américain qui analyse les substrats génétiques des cancers). Il faut aussi compter avec les avancées techniques permettant une extraction rapide des informations génétiques. Un séquenceur d'ADN peut désormais accomplir en un jour ce que le Projet génome humain a réalisé en dix ans – et ce pour quelques milliers de dollars par génome, contre cent millions au début des années 1990. Lointaine époque. Et ce déluge d'informations génétiques va se poursuivre un certain temps encore.

Les mutations génétiques

Les anomalies les plus célèbres sont les variations du gène BRCA, dénommées BRCA1 et BRCA2. Elles peuvent fortement amplifier les risques des cancers du sein et de l'ovaire. Ces mutations sont souvent héréditaires. Mais la génomique du cancer a aussi mis au jour des centaines de mutations génétiques susceptibles d'apparaître spontanément après la naissance. L'apparition de ces anomalies ne peut être prévue ou prévenue. La bonne nouvelle, ici, c'est que le porteur ne peut les transmettre à ses enfants.

On a découvert le lien existant entre le gène SF3B1 et le syndrome myélodysplasique, un type de leucémie. Les anomalies du gène FLT3 (prononcer «flit-3») sont fréquentes chez les malades souffrant de leucémies myéloïdes. De nombreux types de tumeurs cérébrales sont liés à des gènes IDH1 anormaux. On a également observé un lien entre les versions mutées du MLL2/MLL3 et le médulloblastome, le lymphome non-hodgkinien, le cancer de la prostate et le cancer du sein (lien PDF). La liste est longue.

La génétique a accompli de grand progrès: il est aujourd'hui possible de savoir quels gènes sont mutés dans quels cancers, mais aussi de savoir à quel moment la mutation apparaît. Ces recherches sont incroyablement précises. Selon de récentes études, les plus fréquentes des tumeurs solides (celles situées à l'intérieur ou sur les organes, par opposition aux cancers des systèmes sanguin ou lymphatique) contiennent soixante-six mutations pouvant influencer la façon dont se comportent les cellules cancéreuses. A quelle vitesse elles se divisent, si elles réagissent aux signaux qui provoquent la mort des cellules normales, à quel moment elles se détachent de la tumeur principale pour aller coloniser un autre organe, où et à quel moment elles incorporent des vaisseaux sanguins dans des tissus sains. C’est bel et bien à des mutations génétiques que les cellules cancéreuses doivent la plupart des capacités qui leur permettent de se développer.

En tout, on a identifié pas moins de cent quarante gènes qui, une fois mutés, peuvent influencer le développement et la progression d'un cancer. Ce sont les «mutations conductrices», qui sont souvent accompagnées de «mutations passagères», anomalies qui apparaissent durant la progression du cancer mais qui ne stimulent pas la maladie elle-même. La plupart des tumeurs contiennent moins de dix mutations conductrices, mais le nombre total des mutations –passagères et conductrices – peut être bien supérieur: une dizaine dans un neuroblastome, environ deux cent dans un cancer du poumon.

Une histoire d’ADN

Ces mutations cancérigènes obéissent à une logique toute scientifique. C'est pour l'essentiel une histoire de probabilité. Lorsque les cellules se divisent, la double hélice de leur ADN s'ouvre pour permettre la copie du génome – une copie par cellule fille. Nos informations génétiques sont encodées par quatre nucléotides: thymine, cytosine, guanine et adénosine (si l'on s’en tient aux initiales, cela donne T, C, G et A). Chacun de nos gènes (nous en possédons environ vingt mille) est constitué d'une séquence de ces éléments de base. Le Projet génome humain a produit des quantités de données sous cette forme: TCGGGAAATTCGATCCCCAAAATTCTA, etc. (Vous pourrez trouver des séquences génétiques à cette adresse.)

C'est le miracle de la vie – ou du moins l'un d'entre eux. Chacune des cellules de notre organisme contient un exemplaire complet du génome humain. Si l'on déroulait l'ADN de toutes ses cellules, on pourrait faire quatre cents allers et retours entre la Terre et le soleil. Chaque fois qu'une cellule naît (ce qui arrive souvent: environ dix mille milliards de fois lors d’une vie humaine) le génome est copié –et ce depuis l'instant de notre conception jusqu'au jour où nous quittons cette hélice mortelle.

Voilà un sacré paquet de T, de C, de G et de A. Il arrive que des erreurs surviennent pendant la copie. Parfois, un G remplace un C. Il arrive que certains éléments de base ne soient pas copiés. Ou qu'une séquence soit reproduite en sens inverse. Voilà donc ce que sont les mutations génétiques: des erreurs.

Il suffit parfois d'une seule modification pour observer des dégâts importants, et ce même s'il ne s'agit que d'un élément de base. Le gène muté (par exemple le gène APC dans le cas du cancer du côlon) encode une protéine modifiée. Cette protéine permet à la cellule abritant la mutation de se développer plus rapidement que celles qui l'entourent. Au départ, les changements sont minimes, mais au fur et à mesure que les cellules grandissent et qu'elles se divisent plus rapidement, le risque d'apparition d'autres mutations augmente. De ce fait une cellule porteuse de la mutation APC peut devenir porteuse de la mutation KRAS. Cette cellule «bi-mutée» se développe alors encore plus vite. Bientôt, l'une de ces cellules devient porteuse d'une mutation PIK3CA, et devient capable de se frayer un chemin dans les parois du côlon, de se nicher dans un ganglion lymphatique, ou de quitter la maison mère pour voyager jusqu'au foie.

C'est là une affaire de probabilité: plus il y a de cellules, plus y a de risques d'erreur. Plus il y a d'erreurs, plus il y a de risques de voir l'une d'entre elles menacer l’intégrité de l'organisme. Des facteurs environnementaux pourraient aussi augmenter les risques de mutations. Pour l'heure, le tabac, l'exposition aux rayons ultraviolets et l'amiante comptent parmi les seuls éléments dont la dimension cancérigène est considérée comme indiscutable. Le fait est que les cellules cancéreuses se reproduisent plus vite qu'aucune autre, et abritent donc beaucoup plus de mutations. Bientôt, les anomalies de la cellule cancéreuse la poussent à adopter un comportement qui s'avère mortel pour l'organisme.

C'est cela, le cancer. Rien de plus, rien de moins. L'accélération d'un processus corporel tout ce qu'il y a de plus normal. George Johnson résume bien les choses dans son ouvrage The Cancer Chronicles: «Le cancer n'est pas une maladie. C'est un phénomène».

Et c'est précisément pour cela que la génomique du cancer est importante: pas pour les informations qu'elle nous apporte, mais parce que ces informations nous enseignent sur cette maladie – qui est chaque année diagnostiquée chez près de treize millions de personnes dans le monde. Recueillir des informations sans objectif réel constituerait une tâche futile, et inutile pour la majorité d'entre nous. Prises dans leur ensemble, toutefois, ces découvertes nous montrent qu'il est temps d'appréhender le cancer sous un nouveau jour. Cette nouvelle perception pourrait nous permettre de comprendre pourquoi tant de membres de notre espèce (sans parler des membres de notre famille) succombent encore au cancer aujourd'hui.

Il est certes intéressant d'étudier certaines anomalies pour ce qu'elles sont. Le cancer regorge d'éléments aussi complexes que sinistres, tous plus fascinants les uns que les autres. Certains cas de syndromes myélodysplasiques surviennent parce que certains gènes, surnommés «suppresseurs de tumeurs», sont désactivés par un processus appelé méthylation. Cette voie de la méthylation peut être déclenchée par les mutations des gènes TET2, DNMT3A, IDH1 ou IDH2. C'est l'un des centaines de cas où les faits – l'auteur, l'arme, les lieux du crime – sont aujourd'hui connus.

Pourquoi n’existe-t-il pas encore un traitement contre le cancer?

Reste que dans la majorité des cas, nous ne savons que faire de ces connaissances. La quasi-totalité des mutations génétiques – et des erreurs de divisions cellulaires – recensées n'a pas permis la création d'un traitement permettant de cibler le mal à sa source. Et ce n'est pas faute d'avoir essayé. Voilà plusieurs années que les groupes pharmaceutiques tentent de concevoir un médicament permettant de cibler la protéine produite par le gène mutant KRAS. Sans succès. Certaines cibles sont considérées comme «incurables». Il arrive que la forme de la protéine errante soit trop plate ou trop ondulée pour fournir un point d'accroche aux substances médicamenteuses. Dans d'autres cas, on parvient à viser la cible avec un traitement, mais le cancer mute rapidement et parvient à contourner l'obstacle avant que la tumeur puisse être détruite.

Les cancers sont particulièrement variés, ce qui a tendance à compliquer le tout. Les traitements qui ciblent les mutations conductrices ne fonctionnent que chez les patients dont la maladie est guidée par cette mutation conductrice. Les mutations du gène ALK ne sont pas liées à tous les cancers du poumon, ce qui signifie que le médicament crizotinib (qui inhibe l'enzyme mutée) n'est prescrit que chez les patients atteints de ce cancer bien spécifique. Il est très difficile d'identifier quelles sont les mutations conductrices à cibler en priorité. Le gène APC peut ainsi muter de plusieurs façons, mais seule l'une de ces anomalies peut déclencher un cancer. Au fur et à mesure que la tumeur grandit et produit des métastases, les mutations s'additionnent, ce qui complique un peu plus les choses. Passer en revue une tumeur pour identifier les mutations responsables revient à trouver une aiguille microscopique dans une botte de foin. Et dans ce cas précis, de nouvelles aiguilles ne cessent d'apparaître au fur et à mesure que la botte de foin grandit.

Lorsque peu de patients sont porteurs d'une mutation conductrice donnée, cette rareté peut poser problème. Les malades sont souvent trop peu nombreux pour passer le seuil statistique permettant d'autoriser la création d'un nouveau médicament. Il arrive aussi que le laboratoire estime que le nombre de malades n’est pas assez élevé pour générer un retour sur investissement. Le coût et les efforts engagés sont d'autant plus importants qu'une norme de la Food and Drug Administration impose, à toute société demandant l'autorisation d'un médicament ciblant une anomalie provoquée par un gène, de produire des tests diagnostiques pour dépister ladite anomalie. Après tout, à quoi bon développer un traitement ciblé s'il est impossible de dépister la cible chez le patient?

L'intégration d'informations génétiques dans les soins prodigués au malade a des conséquences inattendues dans les hôpitaux. Il arrive qu'on établisse des pronostics différents chez deux patients atteints du même type de cancer, et ce en fonction de leurs mutations génétiques. Il se peut alors qu'un seul des deux malades soit habilité à recevoir une greffe de moelle osseuse comme traitement de première intention. Une intervention coûteuse et difficile à supporter, mais qui peut contribuer à la guérison.

Pour ce qui est du pronostic à long terme, étant donné les nombreuses mutations qu'abrite une cellule cancéreuse, il est peut probable qu'on parvienne un jour à stopper la progression d'une tumeur à l'aide d'un seul traitement. Un cocktail de traitements ciblés serait plus réaliste. Et les combinaisons pourraient éventuellement changer au fil de l'évolution de la maladie. Reste qu'il est interdit de tester deux traitements expérimentaux lors d'un essai clinique –et que même si ce n'était pas le cas, il serait difficile d'amener deux sociétés pharmaceutiques à réaliser des essais conjoints chez l'humain. La firme Gilead a récemment refusé de continuer à tester son traitement expérimental contre le virus de l'hépatite C en association avec un autre produit de Bristol-Myers Squibb, alliance qui avait pourtant abouti à d'incroyables résultats lors des essais préliminaires.

Pour autant, rares sont les chercheurs qui jettent l'éponge. Et cette motivation s'explique en grande partie par l'existence de succès retentissants. En 2001, la FDA a autorisé l'utilisation de la molécule imatinib dans un traitement contre la leucémie myéloïde chronique, maladie universellement provoquée par une seule mutation génétique (le chromosome de Philadelphie), et la protéine mutée qui en résulte. Dix ans plus tard, environ 90% des malades traités avec ce médicament se portent bien (ou sont décédés pour une autre raison). C’est là un résultat des plus extraordinaires. Surtout lorsque l'on sait que le médicament a failli passer à la trappe pendant son élaboration (une histoire si extraordinaire que je l'ai racontée dans un livre).

Pour l'heure le fait qu’un cancer puisse être directement provoqué par une seule et même mutation demeure un cas isolé. Dans la plupart des cas de tumeurs malignes, la situation est bien plus complexe, ce qui complique fortement l'élaboration des traitements. Plusieurs décennies s'écouleront peut-être avant que les informations extraites des tréfonds d'une tumeur puissent être utilisées concrètement. Dans plusieurs années, les malades du cancer verront peut-être leur médecin-biologiste séquencer la tumeur avant d'obtenir le diagnostic. Il ne s'agira plus d'un cancer colorectal, mais d'une tumeur maligne APC/KRAS/PIK3CA. Il se verra alors prescrire une association de trois traitements qu'il pourra prendre à domicile; il s'agira de simples comprimés. Tous les trois mois, le patient retournera à l'hôpital pour une nouvelle analyse, et le traitement sera modifié en fonction des mutations observées au sein de la tumeur.

Une autre vision du cancer, beaucoup moins effrayante. De nombreux cliniciens considèrent que notre génération pourra assister à cette révolution, même si rien ne garantit qu'elle se concrétise un jour. Dans l’attente, à quoi bon se documenter sur la génomique du cancer? L'homme de la rue n'a pas besoin de connaître la liste des 41 gènes qui subissent une mutation chez une personne souffrant du cancer de la prostate. Ce qu'il aimerait peut-être savoir, en revanche, c'est que le cancer est une maladie génétique. Ou que (si l'on en croit les scientifiques d'aujourd'hui) son ami ou son parent n'aurait rien pu faire pour prévenir l'apparition du cancer qui l’a touché. Au final, peut-être voudrait-il simplement savoir comment une maladie si redoutable peut naître du plus fondamental des composants du corps humain.

Article original: http://www.slate.com/articles/health_and_science/human_genome/2013/10/cancer_mutations_genetic_studies_of_tumors_have_not_led_to_many_drugs.html

A LIRE AUSSI

Cancer de la prostate
Témoin de l'effet du cancer de la prostate sur la vie sexuelle

La vie sexuelle après un cancer de la prostate ? Témoignage

La chirurgie du cancer de la prostate a des conséquences physiques et psychologiques. Un homme témoigne...
Lire la suite
Cancer colorectal
L’ail, cette plante aux multiples vertus

L’ail, cette plante aux multiples vertus

Antihypertenseur, mais aussi antibactérien et hypolipémiant (abaisse le taux de cholestérol)… L’ail serait...
Lire la suite
Cancer de la prostate
Troubles sexuels après une intervention chirurgicale pour un cancer de la prostate

Rétablir la fonction érectile après un cancer de la prostate

Après traitement chirurgical du cancer de la prostate, une rééducation de la fonction érectile doit être...
Lire la suite
Articles sur le meme sujet
Le cancer est-il héréditaire?

Le cancer: une maladie héréditaire?

Quand plusieurs membres d’une famille sont touchés par un même cancer, l’hérédité est-elle en cause? Anne Murphy*, infirmière conseillère en oncogénétique (HUG), nous fournit quelques réponses.
Arbre généalogique

Les cancers héréditaires

Certains cas de cancer sont dits héréditaires parce qu’ils résultent de facteurs génétiques présents dans toutes les cellules de l’organisme et que ces facteurs génétiques peuvent être transmis à la descendance. A Genève, comme dans une quinzaine de lieux en Suisse, une consultation propose des dépistages génétiques aux personnes concernées par ce risque.
«Parcours Prévention»: un outil en ligne pour évaluer son risque de cancer

«Parcours Prévention»: un outil en ligne pour évaluer son risque de cancer

En moyenne, une personne sur trois est frappée par un cancer au cours de sa vie en Suisse. Pour certains cancers, il est possible de réduire son risque en adoptant un mode de vie sain.
Videos sur le meme sujet

«Rester soi-même»

Romy Fischer sort grandie de son combat contre le cancer. Témoignage.

Le futur de la médecine

Demain, un tiers de la population aura plus de 65 ans. 40% de la population aura une maladie chronique. Les hôpitaux seront saturés, les médecins trop peu nombreux et les coûts de la santé continueront de prendre l’ascenseur. Dès lors, quelles sont les mesures adoptées par le monde médical pour répondre à ces problématiques?

Cancer du sein: dépister pour mieux soigner

Cancer le plus fréquent chez la femme, surtout après 50 ans, le cancer du sein touche les femmes dans leur intégrité et a une connotation particulière. L'antidote nous aide à faire la lumière sur cette maladie.